circad | circRNAs associated with diseases

circPRKCI/hsa_circ_0067934
Gene	PRKCI	Organism	Human
Genome Locus	chr3:170013698-170015181:+	Build	hg19
Disease	Lung Adenocarcinoma	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29588350
Experimental Method
Sample Type	Tissues	Comparison	primary lung adenocarcinoma tissues and adjacent nontumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATTCAGGGACACCCGTTCTT Reverse CTCTTCAGAACACTTGCAGCTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Qiu, M, Xia, W, Chen, R, Wang, S, Xu, Y, Ma, Z, Xu, W, Zhang, E, Wang, J, Fang, T, Hu, J, Dong, G, Yin, R, Wang, J, Xu, L (2018). The Circular RNA circPRKCI Promotes Tumor Growth in Lung Adenocarcinoma. Cancer Res., 78, 11:2839-2851.